| Gene name |
SPCP31B10.09 |
| Gene ID |
30/H05 |
| Gene synonyms/obsolete |
SPCC962.01 |
| Gene product |
conserved
hypothetical; C2 domain; similar to Sp SPCP31B10.06 |
| Entry clone |
Cloned |
| ORF length (unspliced) |
4470 |
| ORF length (spliced) |
4290 |
| Entry clone length |
4470 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPCP31B10.09.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGAAGGAGAAAACTCGAA |
| Rev primer name |
SPCP31B10.09.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTACTCAGCTTCGACCTTAATT |
| Amino acid length |
1429 |
| Molecular weight |
156 |
| Isoelectric point (calc.) |
6.9 |
| Signal SEQ |
|
| No. of transmembrane domain |
2 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
periphery with faint
ambiguous structure |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |