Gene name |
SPBC25H2.11c |
Gene ID |
30/D05 |
Gene synonyms/obsolete |
|
Gene product |
bromodomain protein;
involved in transcriptional activation; SAGA complex |
Entry clone |
Cloned |
ORF length (unspliced) |
3342 |
ORF length (spliced) |
2940 |
Entry clone length |
3342 |
No. of intron |
7 |
Sequence status |
Finished |
Sequence results |
2553C:T /
2743T:C |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPBC25H2.11.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGAGACTAATTTCGAAGA |
Rev primer name |
SPBC25H2.11.Rv |
Rev primer SEQ |
AGAAAGCTGGGTATTCTTCAGGAAGAGTAGTT |
Amino acid length |
979 |
Molecular weight |
111.5 |
Isoelectric point (calc.) |
4.5 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
944 |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LDSLSVPLHL |
Localization (YFP) |
nucleus |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Leica |