Gene name |
SPBC21C3.20c |
Gene ID |
30/C11 |
Gene synonyms/obsolete |
|
Gene product |
C2 domain; similar to
Sp SPAC11E3.02C |
Entry clone |
Cloned |
ORF length (unspliced) |
3297 |
ORF length (spliced) |
|
Entry clone length |
3297 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPBC21C3.20.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGGATTCACTAGTGTTGA |
Rev primer name |
SPBC21C3.20.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAACTACTCACTCTTTTGACA |
Amino acid length |
1098 |
Molecular weight |
128.2 |
Isoelectric point (calc.) |
5.5 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LLDQIKELLSI/LKMVYSWLQL |
Localization (YFP) |
SPB; periphery at site
of septum formation; nucleus>cytosol |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Leica,
DeltaVision |