Gene name |
SPAC14C4.02c |
Gene ID |
30/C03 |
Gene synonyms/obsolete |
spr18 |
Gene product |
SMC family protein;
possibly dimerizes with rad18 |
Entry clone |
Cloned in 2006
trial |
ORF length (unspliced) |
3247 |
ORF length (spliced) |
3198 |
Entry clone length |
3247 |
No. of intron |
1 |
Sequence status |
Partially
sequenced |
Sequence results |
100% match in both
ends |
Comments |
|
Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
Fwd primer name |
SPAC14C4.02.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGATCTTAACACGCGAGAG |
Rev primer name |
SPAC14C4.02.Rv |
Rev primer SEQ |
AGAAAGCTGGGTATGACGAAGAAATGAGTGCG |
Amino acid length |
1065 |
Molecular weight |
122.9 |
Isoelectric point (calc.) |
5.8 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LVALCHMLKI/LLSLQGLAI |
Localization (YFP) |
SPB; cytosol=nucleus;
nuclear dots; periphery at site of septum formation; spindle
microtubules |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |