| Gene name |
SPBC16G5.16 |
| Gene ID |
29/F07 |
| Gene synonyms/obsolete |
|
| Gene product |
transcriptional
regulator; zinc finger protein; zf-fungal Zn(2)-Cys(6)
binuclear cluster domain |
| Entry clone |
Cloned |
| ORF length (unspliced) |
2861 |
| ORF length (spliced) |
2484 |
| Entry clone length |
2861 |
| No. of intron |
2 |
| Sequence status |
Finished |
| Sequence results |
33T:C / 1787A:G |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC16G5.16.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCTTCCGGCGATGTATC |
| Rev primer name |
SPBC16G5.16.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTACTCGGTTCTTTTAGAGTTT |
| Amino acid length |
827 |
| Molecular weight |
94.5 |
| Isoelectric point (calc.) |
7.3 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
nucleus>cytosol |
| Comments for localization |
cytoplasmic dots by
over expression |
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |