| Gene name |
SPAC22E12.16c |
| Gene ID |
29/F03 |
| Gene synonyms/obsolete |
|
| Gene product |
phosphatidylinositol
kinase; Belongs to the PI3/PI4-kinase family; Contains 1
PI3K/PI4K domain; similar to S. cerevisiae
YNL267W |
| Entry clone |
Cloned |
| ORF length (unspliced) |
2851 |
| ORF length (spliced) |
2556 |
| Entry clone length |
2851 |
| No. of intron |
3 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC22E12.16.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCCATCTTCGAATTCGGG |
| Rev primer name |
SPAC22E12.16.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAGTAAATTCCGTTCGTAATA |
| Amino acid length |
851 |
| Molecular weight |
96.6 |
| Isoelectric point (calc.) |
7.2 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LQAHMVDLGL/LQDISIRLII/LSSLRAELAL |
| Localization (YFP) |
Golgi |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |