| Gene name |
SPAC3G6.09c |
| Gene ID |
29/D02 |
| Gene synonyms/obsolete |
|
| Gene product |
glycosyl transferase
family 20; trehalose-phosphate synthase; similar to Sp TPP1
|
| Entry clone |
Cloned |
| ORF length (unspliced) |
2550 |
| ORF length (spliced) |
|
| Entry clone length |
2550 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
499A:G / 896A:G /
2210T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC3G6.09.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCCTTCAGGCGCGCAAGG |
| Rev primer name |
SPAC3G6.09.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATAGGTTATGCAAAAGTTCT |
| Amino acid length |
849 |
| Molecular weight |
96.3 |
| Isoelectric point (calc.) |
7.5 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LRAFRELLI |
| Localization (YFP) |
cytosol=nucleus |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |