| Gene name |
SPCC320.04c |
| Gene ID |
29/A01 |
| Gene synonyms/obsolete |
|
| Gene product |
eukaryotic conserved
protein; Rho GTPase; involved in apoptosis; ATP/GTP binding;
EF hand motifs; calcium binding protein |
| Entry clone |
Cloned in 2006
trial |
| ORF length (unspliced) |
2488 |
| ORF length (spliced) |
1893 |
| Entry clone length |
2488 |
| No. of intron |
12 |
| Sequence status |
Partially
sequenced |
| Sequence results |
100% match in both
ends |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPCC320.04.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAAAGAAGTTAGAGTAGT |
| Rev primer name |
SPCC320.04.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATTTTTTCGAGTAATATTGG |
| Amino acid length |
630 |
| Molecular weight |
71.1 |
| Isoelectric point (calc.) |
4.7 |
| Signal SEQ |
|
| No. of transmembrane domain |
1 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LTAFGALLL |
| Localization (YFP) |
nucleus>cytosol;
nuclear envelope |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |