| Gene name |
SPAC19E9.02 |
| Gene ID |
28/H11 |
| Gene synonyms/obsolete |
fin1 |
| Gene product |
serine/threonine
protein kinase; NIMA-related kinase; involved in chromatin
condensation (promotion); involved in spindle formation
(regulation); involved in cytokinesis (required); involved in
septation (required); expression peaks at M-G1 phase;
regulated by PBF transcription complex; involved in the
asymmetry of SIN inactivation non-essential |
| Entry clone |
Cloned |
| ORF length (unspliced) |
2483 |
| ORF length (spliced) |
2169 |
| Entry clone length |
2483 |
| No. of intron |
2 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC19E9.02.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGAAAAATACAAGATTCT |
| Rev primer name |
SPAC19E9.02.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAGCCCTCATCATTCGGGCG |
| Amino acid length |
722 |
| Molecular weight |
82.6 |
| Isoelectric point (calc.) |
8.6 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LKFFTQLLL/LLHIPKLGI |
| Localization (YFP) |
SPB;
nucleus>>cytosol; nuclear envelope; cytoplasmic dots
especially at site of septum formation |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |