Gene name |
SPCC825.01 |
Gene ID |
28/H04 |
Gene synonyms/obsolete |
|
Gene product |
ABC transporter;
unknown specificity |
Entry clone |
Cloned |
ORF length (unspliced) |
2469 |
ORF length (spliced) |
|
Entry clone length |
2469 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
570T:C |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPCC825.01.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGCTAGGGGAAAGCGTTC |
Rev primer name |
SPCC825.01.Rv |
Rev primer SEQ |
AGAAAGCTGGGTATTTTTTTTGCTTCTCCAAT |
Amino acid length |
822 |
Molecular weight |
92.6 |
Isoelectric point (calc.) |
6.3 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
179/190/151 |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LADDMDDLSL/LTCVEAVLDI |
Localization (YFP) |
cytosol |
Comments for localization |
|
Effect of LMB on protein
localization |
changed to:
nucleolus>nucleus>cytosol |
Microscope used for
observation |
DeltaVision |