| Gene name |
SPAC24C9.11 |
| Gene ID |
28/H02 |
| Gene synonyms/obsolete |
|
| Gene product |
MIF4G domain; MA3
domain; involved in signal transduction |
| Entry clone |
Cloned |
| ORF length (unspliced) |
2467 |
| ORF length (spliced) |
2328 |
| Entry clone length |
2467 |
| No. of intron |
3 |
| Sequence status |
Finished |
| Sequence results |
19A:G /
85T:addition |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC24C9.11.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAGGCCAATTAAAAAAAG |
| Rev primer name |
SPAC24C9.11.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAATTTCTTCTTTGGAAATG |
| Amino acid length |
775 |
| Molecular weight |
87.8 |
| Isoelectric point (calc.) |
7 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LQGSLNKLSI/LQTLVERFLQL/LVYDLIRLFL/LAKLYASLVI |
| Localization (YFP) |
nucleolus |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |