| Gene name |
SPCC895.07 |
| Gene ID |
28/G03 |
| Gene synonyms/obsolete |
alp14 |
| Gene product |
Mad2-dependent spindle
checkpoint component; Required for bipolar spindle formation
and proper chromosome segregation; has a role in connecting
the kinetochores and the plus end of pole to chromosome
microtubules; also required for the activation of the spindle
checkpoint pathway; MAP215/Dis1 family; HEAT repeat; no
apparent S. cerevisiae ortholog |
| Entry clone |
Cloned |
| ORF length (unspliced) |
2430 |
| ORF length (spliced) |
|
| Entry clone length |
2430 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
705A:G / 1743T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPCC895.07.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAGCCAAGATCAAGAAGA |
| Rev primer name |
SPCC895.07.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAGTGAATCAATCCCTGATGT |
| Amino acid length |
809 |
| Molecular weight |
89.4 |
| Isoelectric point (calc.) |
8.7 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
microtubules; SPB;
cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
changed to:
intranuclear microtubule bundle (nucleus>>cytosol) |
| Microscope used for
observation |
DeltaVision |