| Gene name |
SPAC29B12.02c |
| Gene ID |
28/F02 |
| Gene synonyms/obsolete |
|
| Gene product |
histone lysine
methyltransferase; SET domain; WW domain (inferred from
context) |
| Entry clone |
Cloned |
| ORF length (unspliced) |
2397 |
| ORF length (spliced) |
|
| Entry clone length |
2397 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
1497C:T / 1544C:T /
2288G:A |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC29B12.02.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCAGACGGCATCATCTCT |
| Rev primer name |
SPAC29B12.02.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAGCAGCTTTTTTCGGGGAT |
| Amino acid length |
798 |
| Molecular weight |
90.6 |
| Isoelectric point (calc.) |
8.7 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
651/588 |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LPENVREALGI |
| Localization (YFP) |
nucleus |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |