| Gene name |
SPBC649.01c |
| Gene ID |
28/E12 |
| Gene synonyms/obsolete |
klp6;
SPBC1685.15c |
| Gene product |
kinesin-like protein;
microtubule-destabilizing Kin I family; KIP3 subfamily; non
essential; involved in microtubule disassembly; involved in
meiosis (required); regulates the establishment of metaphase;
regulates the onset of anaphase A; deletion mutant results in
resistance to microtubule poison thiabendazole; deletion
mutant results in abnormally long cytoplasmic microtubules;
involved in chromosome segregation (mitosis); involved in
spindle kinetochore attachment; non-essential; Ras1-Scd
pathway; similar to Sp klp5 (paralog) |
| Entry clone |
Cloned |
| ORF length (unspliced) |
2395 |
| ORF length (spliced) |
2355 |
| Entry clone length |
2395 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
1188G:A |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC649.01.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAAAGAAGGGTCTTCAAT |
| Rev primer name |
SPBC649.01.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAGCATTAGGAGTATTCTCA |
| Amino acid length |
784 |
| Molecular weight |
87.7 |
| Isoelectric point (calc.) |
10 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
cytoplasmic
microtubules; spindle microtubules; SPB; cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
changed to:
intranuclear microtubule bundle (nucleus>cytosol) |
| Microscope used for
observation |
DeltaVision |