Gene name |
SPAC7D4.11c |
Gene ID |
28/C07 |
Gene synonyms/obsolete |
|
Gene product |
hypothetical protein;
similar to N. crassa 15E6.130; no apparent Sc ortholog |
Entry clone |
Cloned/2003.08 |
ORF length (unspliced) |
2310 |
ORF length (spliced) |
|
Entry clone length |
2310 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
664T:C |
Comments |
|
Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
Fwd primer name |
SPAC7D4.11.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAATGAAGACAAATTGGA |
Rev primer name |
SPAC7D4.11.Rv |
Rev primer SEQ |
AGAAAGCTGGGTATTTACGAGGGGGAACTCCT |
Amino acid length |
769 |
Molecular weight |
87.5 |
Isoelectric point (calc.) |
4.5 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LYLLISLII/LAVVHTLVL/LYDDILALDI |
Localization (YFP) |
nucleus>cytosol |
Comments for localization |
ER at low expression
level? |
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |