Gene name |
SPCC613.04c |
Gene ID |
28/A06 |
Gene synonyms/obsolete |
rng3 |
Gene product |
UCS-domain protein;
involved in cytokinesis; involved in contractile ring assembly
(required); involved in assembly of myosin II containing
proteins at the division site; armadillo repeat protein
(inferred from conntext) |
Entry clone |
Cloned |
ORF length (unspliced) |
2241 |
ORF length (spliced) |
|
Entry clone length |
2241 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPCC613.04.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGACCCACGAGCTTTCCTC |
Rev primer name |
SPCC613.04.Rv |
Rev primer SEQ |
AGAAAGCTGGGTATTTGCTTCCTTGAAGTCTA |
Amino acid length |
746 |
Molecular weight |
84.4 |
Isoelectric point (calc.) |
6.8 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LSTVGIELLI/LSQVIPTLKL/LLNNLSKLLL/LLGKFEVLLAL |
Localization (YFP) |
cytosol=nucleus |
Comments for localization |
cytosol>nucleus |
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |