Gene name |
SPBC15D4.07c |
Gene ID |
27/H08 |
Gene synonyms/obsolete |
apg9 |
Gene product |
involved in autophagy;
involved in cytoplasm to vacuole targeting |
Entry clone |
Cloned |
ORF length (unspliced) |
2109 |
ORF length (spliced) |
|
Entry clone length |
2109 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
640T:C / 1169A:G /
1287T:C / 1998T:C |
Comments |
ApaI or SacII should
be used instead of NotI for integration using pDUAL. |
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPBC15D4.07.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTTTTATCAGCCGGCTCA |
Rev primer name |
SPBC15D4.07.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAACGAAGATCCCTTCTAGGT |
Amino acid length |
702 |
Molecular weight |
81.7 |
Isoelectric point (calc.) |
7.4 |
Signal SEQ |
|
No. of transmembrane domain |
6 |
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LWLFLSFLLAL/LGSFTAILVI |
Localization (YFP) |
no apparent
signal |
Comments for localization |
|
Effect of LMB on protein
localization |
not determined |
Microscope used for
observation |
Confocal
|