| Gene name |
SPBC19F5.05c |
| Gene ID |
27/E05 |
| Gene synonyms/obsolete |
SPBC25D12.01c |
| Gene product |
involved in ribosome
biogenesis and assembly; pescadillo-family; BRCT domain |
| Entry clone |
Cloned |
| ORF length (unspliced) |
2016 |
| ORF length (spliced) |
1824 |
| Entry clone length |
2016 |
| No. of intron |
2 |
| Sequence status |
Finished |
| Sequence results |
1352G:A |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC19F5.05.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGCGAGGGTAAAACAGAA |
| Rev primer name |
SPBC19F5.05.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAGTTTTCAACCTTTAATTTT |
| Amino acid length |
607 |
| Molecular weight |
69.1 |
| Isoelectric point (calc.) |
7.1 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
590 |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
nucleolus>>nucleus |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Confocal
|