Gene name |
SPCC1322.08 |
Gene ID |
27/B03 |
Gene synonyms/obsolete |
srk1 |
Gene product |
MAPK-activated protein
kinase; involved in osmotic stress; meiotic regulator;
interacts physically with Sty1p |
Entry clone |
Cloned |
ORF length (unspliced) |
1966 |
ORF length (spliced) |
1743 |
Entry clone length |
1966 |
No. of intron |
1 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPCC1322.08.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCGTTTTAAAGTATGTTT |
Rev primer name |
SPCC1322.08.Rv |
Rev primer SEQ |
AGAAAGCTGGGTACACTTTTTGTCGATGTCGA |
Amino acid length |
580 |
Molecular weight |
66.1 |
Isoelectric point (calc.) |
6.6 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
no apparent
signal |
Comments for localization |
|
Effect of LMB on protein
localization |
not determined |
Microscope used for
observation |
Confocal
|