Gene name |
SPAC11D3.07c |
Gene ID |
26/F11 |
Gene synonyms/obsolete |
|
Gene product |
involved in
transcriptional regulation; zinc finger protein; zf-fungal
Zn(2)-Cys(6) binuclear cluster domain; similar to Sp
SPAPB2C8.02 and SPBC1773.16C and SPBC1773.12 and SPBC530.05
and SPBC530.08 (paralogs) |
Entry clone |
Cloned |
ORF length (unspliced) |
1914 |
ORF length (spliced) |
1812 |
Entry clone length |
1914 |
No. of intron |
1 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPAC11D3.07.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCTCAAAATAAAGCATG |
Rev primer name |
SPAC11D3.07.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAAAGATTCCTCATAACATTG |
Amino acid length |
603 |
Molecular weight |
69.8 |
Isoelectric point (calc.) |
6.5 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LEEKIDLLLDI/LISFYSILAL/LYCPFTPFLII |
Localization (YFP) |
nuclear dots |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |