| Gene name |
SPAC323.03c |
| Gene ID |
26/C09 |
| Gene synonyms/obsolete |
|
| Gene product |
sequence orphan;
hypothetical protein |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1865 |
| ORF length (spliced) |
1728 |
| Entry clone length |
1865 |
| No. of intron |
3 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC323.03.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGAAGAAGCCATTAACAA |
| Rev primer name |
SPAC323.03.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAACTGCACGACCTACGACA |
| Amino acid length |
575 |
| Molecular weight |
66.1 |
| Isoelectric point (calc.) |
7.6 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LPTAVLCHLLL/LFLLTKTLNL |
| Localization (YFP) |
SPB?; dots on spindle
microtubules; periphery at site of septum formation;
nucleus |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |