Gene name |
SPAC26A3.15c |
Gene ID |
26/C06 |
Gene synonyms/obsolete |
|
Gene product |
nucleoporin; nuclear
pore complex; involved in nuclear export; involved in nuclear
import |
Entry clone |
Cloned |
ORF length (unspliced) |
1863 |
ORF length (spliced) |
1797 |
Entry clone length |
1863 |
No. of intron |
1 |
Sequence status |
Finished |
Sequence results |
384A:G / 937A:G |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPAC26A3.15.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTGTAAGTGTAAGAGGCG |
Rev primer name |
SPAC26A3.15.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAGAACAAAACGTCAGAATTC |
Amino acid length |
598 |
Molecular weight |
60.7 |
Isoelectric point (calc.) |
5.3 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
nuclear envelope |
Comments for localization |
large dots by over
expression |
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |