Gene name |
SPAC1B1.01 |
Gene ID |
26/A12 |
Gene synonyms/obsolete |
rdp1 |
Gene product |
transcription factor;
zinc finger protein; zf-C2H2 type; regulator of rhp51 whose
promoter has damage responsive elements (DREs); essential; no
apparent orthologs |
Entry clone |
Cloned |
ORF length (unspliced) |
1633 |
ORF length (spliced) |
1437 |
Entry clone length |
1633 |
No. of intron |
1 |
Sequence status |
Finished |
Sequence results |
122A:G / 542A:G /
895C:A |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPAC1B1.01.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAGTGAGCACTCGCCAGA |
Rev primer name |
SPAC1B1.01.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAACAATTCTGGAAGTCTAAG |
Amino acid length |
478 |
Molecular weight |
51.7 |
Isoelectric point (calc.) |
8 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LHLRLANLRI |
Localization (YFP) |
nuclear dots;
nucleus |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |