Gene name |
SPCC962.03c |
Gene ID |
26/A09 |
Gene synonyms/obsolete |
cut15 |
Gene product |
alpha-importin/karyopherin; serine rich RNA
polymerase I suppressor; involved in mitosis; involved in
chromosome condensation (required); armadillo repeat protein;
similar to Sp SPBC1604.08C |
Entry clone |
Cloned |
ORF length (unspliced) |
1629 |
ORF length (spliced) |
|
Entry clone length |
1629 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
1116A:G |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPCC962.03.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAGTGCATCTTCTCGCTT |
Rev primer name |
SPCC962.03.Rv |
Rev primer SEQ |
AGAAAGCTGGGTACATAGCCATATCTTCGGCA |
Amino acid length |
542 |
Molecular weight |
60.4 |
Isoelectric point (calc.) |
4.5 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
nuclear envelope |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |