Gene name |
SPBC2G2.12 |
Gene ID |
25/H06 |
Gene synonyms/obsolete |
|
Gene product |
histidine-tRNA ligase;
involved in histidyl-tRNA aminoacylation; histidine-tRNA
ligase activity |
Entry clone |
Cloned |
ORF length (unspliced) |
1617 |
ORF length (spliced) |
|
Entry clone length |
1617 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
1458A:G |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPBC2G2.12.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGCTGATTCTCTAGTAGA |
Rev primer name |
SPBC2G2.12.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAATCGTATTTAAGTAACTTT |
Amino acid length |
538 |
Molecular weight |
60.2 |
Isoelectric point (calc.) |
6.9 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LLQLKNLKL |
Localization (YFP) |
cytosol |
Comments for localization |
|
Effect of LMB on protein
localization |
changed to:
cytosol=nucleus |
Microscope used for
observation |
DeltaVision |