Gene name |
SPCC550.09 |
Gene ID |
25/G10 |
Gene synonyms/obsolete |
|
Gene product |
conserved
hypothetical; hypothetical protein; dysferlin domain-domain of
unknown function present in yeast peroxisomal proteins
(SMART) |
Entry clone |
Cloned |
ORF length (unspliced) |
1608 |
ORF length (spliced) |
|
Entry clone length |
1608 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
341A:G / 572A:G /
575A:G / 833T:C |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPCC550.09.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGATTCGCGCACATTTGTT |
Rev primer name |
SPCC550.09.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAAAGTGCTTCAGCACCATTA |
Amino acid length |
535 |
Molecular weight |
60.2 |
Isoelectric point (calc.) |
6.4 |
Signal SEQ |
Predicted
(N-terminus) |
No. of transmembrane domain |
2 |
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LTTLFFTWLII |
Localization (YFP) |
cytoplasmic dots;
ambiguous structure |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |