Gene name |
SPAC6G10.12c |
Gene ID |
25/F09 |
Gene synonyms/obsolete |
|
Gene product |
zinc finger protein;
zf-C2H2 type (3); regulator of eng1; possibly involved in
metallothionein expression; deletion mutant displays severe
cell separation defects; involved in cytokinesis; involved in
septation; involved in cell separation (regulation) |
Entry clone |
Cloned
(Re-cloned) |
ORF length (unspliced) |
1602 |
ORF length (spliced) |
|
Entry clone length |
1602 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
Fwd primer name |
SPAC6G10.12.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCGCTTTCATATTTATC |
Rev primer name |
SPAC6G10.12.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAGTGCTGTCTGCGATCTACG |
Amino acid length |
533 |
Molecular weight |
59.8 |
Isoelectric point (calc.) |
5.5 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
almost no apparent
signal |
Comments for localization |
|
Effect of LMB on protein
localization |
not determined |
Microscope used for
observation |
DeltaVision |