Gene name |
SPCC757.13 |
Gene ID |
25/C11 |
Gene synonyms/obsolete |
|
Gene product |
transporter; unknown
specificity; allantoate permease family; similar to Sp
SPCC417.10 and SPBC1773.15 |
Entry clone |
Cloned |
ORF length (unspliced) |
1569 |
ORF length (spliced) |
|
Entry clone length |
1569 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPCC757.13.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCTTCCATCACTTCAAG |
Rev primer name |
SPCC757.13.Rv |
Rev primer SEQ |
AGAAAGCTGGGTACCATCTATAACGAAATTTG |
Amino acid length |
522 |
Molecular weight |
58.6 |
Isoelectric point (calc.) |
8.9 |
Signal SEQ |
|
No. of transmembrane domain |
12 |
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LIGVFMNCLTL |
Localization (YFP) |
ER |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |