Gene name |
SPCC1795.09 |
Gene ID |
25/C08 |
Gene synonyms/obsolete |
|
Gene product |
aspartic protease;
yapsin subfamily; GPI anchored protein; glycoprotein;
spcificity C terminal to basic or dibasic amino acids;
cleavage site Ser-17; cleavage site Lys-Arg45; localization
cell wall; GPI attachment site Asn-495; involved in cell wall
biosynthesis (implicated); overexpression rescues krp1 mutant
|
Entry clone |
Cloned |
ORF length (unspliced) |
1566 |
ORF length (spliced) |
|
Entry clone length |
1566 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
470A:G |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPCC1795.09.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAGGATTTGGATTTTAAT |
Rev primer name |
SPCC1795.09.Rv |
Rev primer SEQ |
AGAAAGCTGGGTATATAATACCGAGTCCTAAA |
Amino acid length |
521 |
Molecular weight |
57.6 |
Isoelectric point (calc.) |
4.4 |
Signal SEQ |
Predicted
(N-terminus) |
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
ER |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |