| Gene name |
SPCC777.14 |
| Gene ID |
25/A06 |
| Gene synonyms/obsolete |
prp4 |
| Gene product |
serine/threonine
protein kinase; essential; involved in mRNA splicing;
regulates pre-mRNA splicing by phosphorylating a
non-SR-splicing factor; no apparent Sc ortholog |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1542 |
| ORF length (spliced) |
1434 |
| Entry clone length |
1542 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
289T:C / 1088T:C /
1356T:A / 1396T:A |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPCC777.14.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAGTGACGATAGATTTGC |
| Rev primer name |
SPCC777.14.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATTTTTTTATAAAGAAAGGA |
| Amino acid length |
477 |
| Molecular weight |
55.2 |
| Isoelectric point (calc.) |
8 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
15 |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LCMVFEMLSL/LMDLLEKCLEL |
| Localization (YFP) |
no apparent
signal |
| Comments for localization |
|
| Effect of LMB on protein
localization |
not determined |
| Microscope used for
observation |
DeltaVision |