| Gene name |
SPCC417.05c |
| Gene ID |
24/H12 |
| Gene synonyms/obsolete |
|
| Gene product |
Chs4 homologue; SEL1
repeat protein; involved in chitin biosynthesis; similar to Sp
SPBC1289.01C and SPAC24B11.10C and SPBC3E7.12C |
| Entry clone |
Cloned# |
| ORF length (unspliced) |
1539 |
| ORF length (spliced) |
|
| Entry clone length |
1539 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPCC417.05.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCTAGTTAGCAATGGCGG |
| Rev primer name |
SPCC417.05.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTACGATATAATGCATGATTCT |
| Amino acid length |
512 |
| Molecular weight |
58.4 |
| Isoelectric point (calc.) |
6.7 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
488 |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LSPFKELEI |
| Localization (YFP) |
nucleus>>cytosol; periphery at site of septum
formation |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |