Gene name |
SPAC22A12.16 |
Gene ID |
24/H08 |
Gene synonyms/obsolete |
|
Gene product |
ATP-citrate synthase
(subunit 2) (similar to ATP-citrate synthase N-terminal
domain); involved in tricarboxylic acid cycle; involved in
citrate metabolism; involved in ATP catabolism; involved in
acetyl CoA biosynthesis; involved in fatty acid biosynthesis;
ATP citrate synthase activity; no apparent Sc ortholog |
Entry clone |
Cloned |
ORF length (unspliced) |
1538 |
ORF length (spliced) |
1479 |
Entry clone length |
1538 |
No. of intron |
1 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPAC22A12.16.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCTGCCAAGTCAATTAG |
Rev primer name |
SPAC22A12.16.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAAGCCATCTGCCATTCAGCT |
Amino acid length |
492 |
Molecular weight |
53.9 |
Isoelectric point (calc.) |
5.9 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
cytosol=nucleus |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Leica |