Gene name |
SPBC119.14 |
Gene ID |
24/F11 |
Gene synonyms/obsolete |
rti1 |
Gene product |
involved in DNA
repair; involved in double-strand break repair; essential;
involved in S phase completion (required); similar to Sp
rad22 |
Entry clone |
Cloned |
ORF length (unspliced) |
1522 |
ORF length (spliced) |
1116 |
Entry clone length |
1522 |
No. of intron |
5 |
Sequence status |
Finished |
Sequence results |
420A:G |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPBC119.14.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGGCTCGCTACCTGATCA |
Rev primer name |
SPBC119.14.Rv |
Rev primer SEQ |
AGAAAGCTGGGTATTTCGTTGAGAACGTGTTT |
Amino acid length |
371 |
Molecular weight |
41.8 |
Isoelectric point (calc.) |
6.5 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
nuclear dots |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Confocal,
DeltaVision |