| Gene name |
SPAC13A11.02c |
| Gene ID |
24/A02 |
| Gene synonyms/obsolete |
cyp51 |
| Gene product |
probable cytochrome
P450 51 |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1488 |
| ORF length (spliced) |
|
| Entry clone length |
1488 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC13A11.02.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGCATTCTCTTTAGTTTC |
| Rev primer name |
SPAC13A11.02.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAATTACGACGCTTCCAAGCA |
| Amino acid length |
495 |
| Molecular weight |
56.3 |
| Isoelectric point (calc.) |
9 |
| Signal SEQ |
Predicted
(N-terminus) |
| No. of transmembrane domain |
2 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LNYVIQETLRL |
| Localization (YFP) |
ER |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Confocal |