| Gene name |
SPAC6F12.11c |
| Gene ID |
23/H02 |
| Gene synonyms/obsolete |
sfc1 |
| Gene product |
RNA polymerase III
transcription factor (TFIIIC subunit); A box associated
binding subunit |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1479 |
| ORF length (spliced) |
1371 |
| Entry clone length |
1479 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
1444A:G |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC6F12.11.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAATAGTCTAAAAATTTC |
| Rev primer name |
SPAC6F12.11.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAATCACCAAATATATCATCG |
| Amino acid length |
456 |
| Molecular weight |
52.7 |
| Isoelectric point (calc.) |
7.6 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
cytosol; a few
cytoplasmic dots |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |