Gene name |
SPBC21D10.12 |
Gene ID |
23/F06 |
Gene synonyms/obsolete |
hob1 |
Gene product |
BAR domain; src (SH3)
homology domain; non-essential; involved in stress response,
cell cycle regulation; Sc RVS167; actin cortical patch
component |
Entry clone |
Cloned |
ORF length (unspliced) |
1469 |
ORF length (spliced) |
1401 |
Entry clone length |
1469 |
No. of intron |
1 |
Sequence status |
Finished |
Sequence results |
434T:C |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPBC21D10.12.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAGCTGGAAAGGGTTTAC |
Rev primer name |
SPBC21D10.12.Rv |
Rev primer SEQ |
AGAAAGCTGGGTATTCAAGCTGAACATAATTA |
Amino acid length |
466 |
Molecular weight |
51.3 |
Isoelectric point (calc.) |
5 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
mitochondrion |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |