| Gene name |
SPAC1A6.10 |
| Gene ID |
23/E06 |
| Gene synonyms/obsolete |
SPAC30D11.15c |
| Gene product |
Moeb/ThiF domain |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1458 |
| ORF length (spliced) |
|
| Entry clone length |
1458 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
654T:C / 940T:C /
1107T:G |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC1A6.10.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGAAACGCTGCAAGTCGA |
| Rev primer name |
SPAC1A6.10.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAATAAAGCATTTCCCACATT |
| Amino acid length |
485 |
| Molecular weight |
54.2 |
| Isoelectric point (calc.) |
6.3 |
| Signal SEQ |
|
| No. of transmembrane domain |
2 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
mitochondrion |
| Comments for localization |
aggregates by over
expression |
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |