Gene name |
SPAC31A2.01 |
Gene ID |
23/C02 |
Gene synonyms/obsolete |
csn71; csn7b; csn7;
csn7-2; SPAC1751.03 |
Gene product |
COP9/signalosome
complex (subunit 7b); PCI domain; no apparent Sc
ortholog |
Entry clone |
Cloned |
ORF length (unspliced) |
1443 |
ORF length (spliced) |
1209 |
Entry clone length |
1443 |
No. of intron |
2 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPAC31A2.01.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGAAGGCTCTGATTTTAT |
Rev primer name |
SPAC31A2.01.Rv |
Rev primer SEQ |
AGAAAGCTGGGTATTCAGAGGCTGTGACCGCG |
Amino acid length |
402 |
Molecular weight |
45 |
Isoelectric point (calc.) |
4.7 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LNLFLTRLPL/LTPAILSVLSI |
Localization (YFP) |
nucleus>cytosol |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |