| Gene name |
SPAC19E9.01c |
| Gene ID |
22/F07 |
| Gene synonyms/obsolete |
|
| Gene product |
nucleoporin;
non-essential; Functions as a component of the nuclear pore
complex (NPC); NPC components, collectively referred to as
nucleoporins (NUPs), can play the role of both NPC structural
components and of docking or interaction partners for
transiently associated nuclear transport factors. Active
directional transport is assured by both, a Phe-Gly (FG)
repeat affinity gradient for these transport factors across
the NPC and a transport cofactor concentration gradient across
the nuclear envelope (GSP1 and GSP2 GTPases associated
predominantly with GTP in the nucleus, with GDP in the
cytoplasm) |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1303 |
| ORF length (spliced) |
1116 |
| Entry clone length |
1303 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
853A:G / 951A:T /
1225T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC19E9.01.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCTTTTGGGGGAAGTGG |
| Rev primer name |
SPAC19E9.01.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAAACCCAAACAATGTGTGC |
| Amino acid length |
371 |
| Molecular weight |
40.2 |
| Isoelectric point (calc.) |
7.8 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
nuclear envelope |
| Comments for localization |
cytoplasmic dots by
over expression |
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |