Gene name |
SPCC830.02 |
Gene ID |
22/F03 |
Gene synonyms/obsolete |
wtf24;
wtf10-pseudo |
Gene product |
wtf element |
Entry clone |
Cloned |
ORF length (unspliced) |
1301 |
ORF length (spliced) |
1040 |
Entry clone length |
1301 |
No. of intron |
3 |
Sequence status |
Finished |
Sequence results |
237C:T / 723T:C |
Comments |
pseudogene |
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPCC830.02.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAAGAATAATTACGCTTC |
Rev primer name |
SPCC830.02.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAGACTTCGCTTTCAACTTCC |
Amino acid length |
|
Molecular weight |
|
Isoelectric point (calc.) |
|
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
no apparent
signal |
Comments for localization |
|
Effect of LMB on protein
localization |
not determined |
Microscope used for
observation |
Leica |