Gene name |
SPAC22A12.10 |
Gene ID |
22/B04 |
Gene synonyms/obsolete |
|
Gene product |
aminoalcoholphosphotransferase; involved in
phosphatidylethanolamine biosynthesis |
Entry clone |
Cloned |
ORF length (unspliced) |
1211 |
ORF length (spliced) |
1161 |
Entry clone length |
1211 |
No. of intron |
1 |
Sequence status |
Finished |
Sequence results |
457T:C / 944T:C |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPAC22A12.10.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCAGTTAAACCGGAAGCA |
Rev primer name |
SPAC22A12.10.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAATTCTTCTTGGACTCTGGT |
Amino acid length |
386 |
Molecular weight |
44 |
Isoelectric point (calc.) |
7.2 |
Signal SEQ |
|
No. of transmembrane domain |
8 |
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LLTIELLQL/LYNFMAFALLL |
Localization (YFP) |
no apparent
signal |
Comments for localization |
|
Effect of LMB on protein
localization |
not determined |
Microscope used for
observation |
Leica |