Gene name |
SPBC28F2.05c |
Gene ID |
22/A10 |
Gene synonyms/obsolete |
|
Gene product |
Aldo/keto reductase;
similar to Sp SPAP32A8.02 and SPAC2F3.05C |
Entry clone |
Cloned/2003.08 |
ORF length (unspliced) |
831 |
ORF length (spliced) |
|
Entry clone length |
831 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
584A:G |
Comments |
|
Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
Fwd primer name |
SPBC28F2.05.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAAACCATTTTCTCCTTC |
Rev primer name |
SPBC28F2.05.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAAGGAAGTATAATAGGATTC |
Amino acid length |
276 |
Molecular weight |
32 |
Isoelectric point (calc.) |
8.1 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LEEIISLGLPL/LSDIRLLDL |
Localization (YFP) |
nucleus>=cytosol |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |