| Gene name |
SPBC11G11.02c |
| Gene ID |
21/H02 |
| Gene synonyms/obsolete |
end3 |
| Gene product |
actin cortical patch
component; involved in endocytosis; EF hand motif; calcium
binding protein |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1422 |
| ORF length (spliced) |
1128 |
| Entry clone length |
1422 |
| No. of intron |
2 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC11G11.02.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGATCCCCAAGAGAAAAA |
| Rev primer name |
SPBC11G11.02.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAGACAGACTACGAAGCCTT |
| Amino acid length |
375 |
| Molecular weight |
42.1 |
| Isoelectric point (calc.) |
5.7 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LQKVLDYKLGI |
| Localization (YFP) |
no apparent
signal |
| Comments for localization |
|
| Effect of LMB on protein
localization |
not determined |
| Microscope used for
observation |
DeltaVision |