Gene name |
SPAC823.08c |
Gene ID |
21/F05 |
Gene synonyms/obsolete |
|
Gene product |
ATP-dependent RNA
helicase; DEAD/DEAH box helicase; involved in rRNA
processing |
Entry clone |
Cloned |
ORF length (unspliced) |
1398 |
ORF length (spliced) |
|
Entry clone length |
1398 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
732A:G |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPAC823.08.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGCACCTTCTGAGAAAAA |
Rev primer name |
SPAC823.08.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAATAGATTTGTTCTTCACGA |
Amino acid length |
465 |
Molecular weight |
51.8 |
Isoelectric point (calc.) |
9.7 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
441 |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
nucleus>=cytosol |
Comments for localization |
|
Effect of LMB on protein
localization |
changed to:
nucleus>cytosol |
Microscope used for
observation |
DeltaVision |