| Gene name |
SPBC660.11 |
| Gene ID |
20/H08 |
| Gene synonyms/obsolete |
tcg1 |
| Gene product |
single-stranded TG1-3
telomeric binding protein; rrm RNA recognition motif;
RNA-binding protein |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1350 |
| ORF length (spliced) |
1047 |
| Entry clone length |
1350 |
| No. of intron |
2 |
| Sequence status |
Finished |
| Sequence results |
474T:C / 885T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC660.11.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCCGCTGAGGAAACTGT |
| Rev primer name |
SPBC660.11.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAGGCAGTTATAGCACTAGCA |
| Amino acid length |
348 |
| Molecular weight |
37.8 |
| Isoelectric point (calc.) |
5.2 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
cytosol |
| Comments for localization |
a few cytoplasmic dots
by over expression |
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |