| Gene name |
SPAC1F5.03c |
| Gene ID |
20/H05 |
| Gene synonyms/obsolete |
|
| Gene product |
oxidoreductase;
similar to D-amino-acid oxidases |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1350 |
| ORF length (spliced) |
1149 |
| Entry clone length |
1350 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
172T:C / 753T:C /
1092A:G |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC1F5.03.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAGCAATTCTCGAAACAT |
| Rev primer name |
SPAC1F5.03.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATTCCAAAGAACCTTCCGGA |
| Amino acid length |
382 |
| Molecular weight |
41.5 |
| Isoelectric point (calc.) |
4.6 |
| Signal SEQ |
Predicted
(N-terminus) |
| No. of transmembrane domain |
1 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
nucleus>>cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |