| Gene name |
SPAC30D11.11 |
| Gene ID |
20/E09 |
| Gene synonyms/obsolete |
|
| Gene product |
widely conserved
protein; UPF0073; involved in the regulation of lipid and
phosphate metabolism; PAC domain (SMART) which is implicated
signal transduction and transcriptional regulation (inferred
from context) |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1329 |
| ORF length (spliced) |
|
| Entry clone length |
1329 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
59T:C / 237A:G /
312A:T / 777T:C / 1272T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC30D11.11.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCGACCGTCAAAACGTT |
| Rev primer name |
SPAC30D11.11.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTACAGCACGCCGCATGAAAAT |
| Amino acid length |
442 |
| Molecular weight |
51 |
| Isoelectric point (calc.) |
9.3 |
| Signal SEQ |
|
| No. of transmembrane domain |
7 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LEEFIVLKLDL |
| Localization (YFP) |
ER; Golgi |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |