Gene name |
SPAC17A5.11 |
Gene ID |
20/E02 |
Gene synonyms/obsolete |
rec12 |
Gene product |
Spo11/Top6A
topoisomerase family; expression meiosis induced; involved in
meiotic recombination (required); involved in meiotic dsDNA
break formation (required); deletion mutant results in
recombination defects; deletion mutant results in segregation
defects; mutant rec12-117 lacked most crossover recombination;
mutant rec12-117 segregated abnormally; mutant rec12-Y98F
segregated abnormally; mutant rec12-Y98F lacked most crossover
recombination |
Entry clone |
Cloned |
ORF length (unspliced) |
1279 |
ORF length (spliced) |
1038 |
Entry clone length |
1279 |
No. of intron |
4 |
Sequence status |
Finished |
Sequence results |
1125A:G |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPAC17A5.11.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAATTCGAATGATAAAAA |
Rev primer name |
SPAC17A5.11.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAACGTACTGAGTGCTTTCCA |
Amino acid length |
345 |
Molecular weight |
39.3 |
Isoelectric point (calc.) |
9.7 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
nucleus>>cytosol
|
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |