| Gene name |
SPAC9G1.04 |
| Gene ID |
20/C03 |
| Gene synonyms/obsolete |
oxa101; oxa1; oxa1-1;
cox18; oxa1sp1 |
| Gene product |
respiratory complex
biogenesis protein; cytochrome c oxidase assembly protein;
localization mitochondrial inner membrane; similar to Sp
oxa102 (paralog); essential with oxa102 |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1266 |
| ORF length (spliced) |
1125 |
| Entry clone length |
1266 |
| No. of intron |
2 |
| Sequence status |
Finished |
| Sequence results |
317T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC9G1.04.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTTACATTTTCTAATTAG |
| Rev primer name |
SPAC9G1.04.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAGTTACTTTGCTTCTTTGAA |
| Amino acid length |
374 |
| Molecular weight |
42 |
| Isoelectric point (calc.) |
10.9 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LTTLGVRLAL/LAWFKDLSI |
| Localization (YFP) |
mitochondrion |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |