| Gene name |
SPBC16H5.09c |
| Gene ID |
20/B07 |
| Gene synonyms/obsolete |
|
| Gene product |
glycosyl transferase
family 15; similar to S. pombe SPCC777.07 and SPBC19C7.12c;
similar to S. cerevisiae YOR099W and YKR061W and
YJL139C and YDR483W and YBR205W and YBR199W and YPL053C;
conserved fungal protein |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1262 |
| ORF length (spliced) |
1119 |
| Entry clone length |
1262 |
| No. of intron |
3 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC16H5.09.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCGGATATCAAGATTGCT |
| Rev primer name |
SPBC16H5.09.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATAATTCATCGTAGTCTTCG |
| Amino acid length |
372 |
| Molecular weight |
44.3 |
| Isoelectric point (calc.) |
6.9 |
| Signal SEQ |
Predicted
(N-terminus) |
| No. of transmembrane domain |
1 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LLGFVILFI |
| Localization (YFP) |
ER |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |